This is a higher level of assessment and analysis. After lessons on Human cell analysis, Genetics and Inheritance, Human Traits and Development. Understanding the corresponding uses and their importance in the inheritance or heredity of children in the family and in the next generations.Test your knowledge on DNA, RNA, and Protein molecular structure and function. Determine structures and the functions of each molecule and compound. Analysis if synthesis of new protein molecules from amino substances.
Lesson Review on BioMolecules : Structure and Function
Lesson Review on Biomolecules : DNA Replication and Protein Synthesis
BioMolecules Practice Quiz 1
Genetics Disorders Practice Quiz
BioMolecules Quiz 2
-------
Subscribe to:
Post Comments (Atom)
Justin Troy C. Jopia
ReplyDelete12-Salem
A.5'ATCGATAGATTAGGATATCCCAGATAG3'
33'TAGCTATCTAATCCTATAGGGTCTATC5'
B.TACATCTAATCCTATAGGGTCTATC5'
5'AUGCUAGAUUAGGAUACCCCAGAUAG3'